Units

• 1 mg = 10-3 g
  1 ug = 10-6 g
  1 ng = 10-9 g
  1 pg = 10-12 g

• 1 kb of double stranded DNA = 660 kD
  1 kb of single stranded DNA = 330 kD
  1 kb of single stranded RNA = 340 kD

• Average MW of a deoxynucleotide base = 324.5 Daltons
  Average MW of a deoxynucleotide base pair = 649 Daltons

• 1 ug/ml of DNA = 3.08 uM phosphate
  1 ug/ml of 1 kb of DNA = 3.08 nM 5' ends
  1 mol of pBR322 = 2.83 x10+6 g.
  1 pmol of linear pBR322, 5' ends = 1.4 ug
  1 A260 unit of duplex DNA = 50 ug
  1 A260 unit of single-stranded DNA = 37 ug
  1 A260 unit of single-stranded RNA = 50 ug

• 1 kb of DNA = 333 amino acids of coding capacity
  = 37,000 daltons
  
• Densities (50% GC):

RF I (supercoiled) ds DNA	1.709 g/ml
RF II (nicked) ds DNA	1.54 g/ml
ss DNA	1.726 g/ml
ss RNA	1.90 g/ml
protein	1.33 g/ml

Formulas

• DNA melting point:
• For duplex DNA >50 bp:
  
  Tm = 81.5deg. C +16.6 log (M of NaCl) + 0.41(% GC)
  - [500/bp of shortest chain in duplex]
  - [0.65(% formamide)]
  
  For duplex DNA <50 bp:
  
  Add 2deg. C for each A or T
  Add 4deg. C for each G or C
  
• Picomoles of ends:

• pmol ends per ug linear DNA = 3030/number of bases

DNA mobility in gels

• Migration of marker dyes in native polyacrylamide non-denaturing gels

• Migration of marker dyes in polyacrylamide denaturing gels

• Relative positions of different DNA forms on Tris-acetate agarose gels

The exact distance between bands is influenced by percentage of agarose, time of electrophoresis, concentration of Ethidium bromide, degree of supercoiling and the size and complexity of the DNA.

Amino acid symbols

Alanine                         	Ala     A
Arginine                        	Arg     R
Asparagine                      	Asn     N
Aspartic acid           		Asp     D
Asparagine or Aspartic acid     	Asx     B
Cysteine                        	Cys     C
Glutamine                       	Gln     Q
Glutamic acid                   	Glu     E
Glutamine or Glutamic acid      	Glx     Z
Glycine                       		Gly     G
Histidine                       	His     H
Isoleucine                      	Ile     I
Leucine                 		Leu     L
Lysine                  		Lys     K
Methionine                      	Met     M
Phenylalanine                   	Phe     F
Proline                 		Pro     P
Serine                  		Ser     S
Threonine				Thr     T
Tryptophan                      	Trp     W
Tyrosine                        	Tyr     Y
Valine                  		Val     V

Commonly used restriction enzymes and assay buffers

Assay buffers (see enzyme vendors catalogs for additional information)

10x Low salt buffer				10x Core buffer

   100mM Tris-HCl, pH 7.6		500mM NaCl
   100mM MgCl2				500mM Tris-HCl, pH 7.6
    10mM DTT				100mM MgCl2

10x Medium salt buffer			10x Hind buffer

   500mM NaCl				600mM NaCl
   100mM Tris-HCl, pH 7.6		100mM Tris-HCl, pH 7.6
   100mM MgCl2				 70mM MgCl2
    10mM DTT


10x High salt buffer			10x Sma I buffer (1)

    1.0M NaCl				200mM KCl
   500mM Tris-HCl, pH 7.6		100mM Tris-HCl, pH 7.6
   100mM MgCl2				100mM MgCl2
    10mM DTT				10mM DTT

Heat inactivation of restriction enzymes

• The following enzymes CAN be heat inactivated by incubation at 65 deg. C for 10 min.: Alu I, Apa I, Ava II, Bal I, Bgl I, Cvn I, Dpn I, Dra I, Eco R II, Eco RV, Hae II, Hha I, Hinc II, Kpn I, Mbo I, Msp I, Nar I, Nde II, Rsa I, Sau 3a, Sca I, Sfi I, Spe I, Sph I, Ssp I, Sst I, Stu I, and Sty I.
• The following enzymes are ONLY PARTIALLY heat inactivated by incubation at 65 deg.C for 10 min.: Ava I, Cfo I, Cla I, Cvn I, Eco RI, Mbo II, Mlu I, Nci I, Nru I, Pst I, Pvu II, Sma I and Xma III
• The following enzymes CANNOT be heat inactivated by incubation at 65 deg. C for 10 min.: Acc I, Bam HI, Bcl I, Bgl II, BstE II, Dde I, Hae III, Hind III, Hinf I, Hpa I, Hpa II Nde I, Nhe I, Nsi I, Pvu I, Sal I, Sau 96 I, Sst II, Taq I, Tha I, Xba I, Xho I, and Xor II.

Oligonucleotide universal primers used for DNA sequencing

M13 (-21) universal forward 5'-TGT-AAA-ACG-ACG-GCC-AGT-3'

M13 (-40) universal forward 5'-GTT-TTC-CCA-GTC-ACG-AC-3'

M13/pUC reverse primer 5'-CAG-GAA-ACA-GCT-ATG-ACC-3'

T7 primer 5'-TAA-TAC-GAC-TCA-CTA-TAG-GG-3'

SP6 primer 5'-ATT-TAG-GTG-ACA-CTA-TAG-3'

-16bs 5'-TCG-AGG-TCG-ACG-GTA-TCG-3'

+19bs 5'-GCC-GCT-CTA-GAA-CTA-GTG-3'

Listing of M13 (pUC) cloning sites

As they are read on DNA sequencing gels using the Universal primer:

M13mp7
.......EcoR1....BamH1.SalI..PstI..SalI..BamH1....EcoR1
GGCCAGTGAATTCCCCGGATCCGTCGACCTGCAGGTCGACGGATCCGGGGAATTC

M13mp8
..........HindIII.PstI.SalI...BamH1.SmaI.EcoR
GGCCAGTGCCAAGCTTGGCTGCAGGTCGACGGATCCCCGGGAATTCGTAATCATG

M13mp9
.......EcoR1.SmaI.BamH1..SalI..PstI..HindIII
GGCCAGTGAATTCCCGGGGATCCGTCGACCTGCAGCCAAGCTTGGCGTAATCATG

M13mp10
...HindIII..PstI..SalI..XbaI..BamH1..SmaI..SstI..EcoR1
GCCAAGCTTGGGCTGCAGGTCGACTCTAGAGGATCCCCGGGCGAGCTCGAATTCG

M13mp11
...EcoR1..SstI..SmaI..BamH1..XbaI..SalI..PstI..HindIII
GTGAATTCGAGCTCGCCCGGGGATCCTCTAGAGTCGACCTGCAGCCCAAGCTTGG

M13mp18
HindIII.SphI..PstI..SalI.XbaI.BamH1.SmaI.KpnI.SstI.EcoR1
AAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTC

M13mp19
EcoR1.SstI.KpnI.SmaI.BamH1.XbaI.SalI.PstI..SphI..HindIII
GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT