Hiro Hirai's PRINS Protocol

Overview

The PRINS (Primed in situ) technique uses a specific primer, dNTPs with Dig-11-dUTP and DNA polymerase to perform a primer extension reaction on a chromosome preparation. To date it has been used to localise the telomeric repeat element and the Sm alpha repeat element on S. mansoni chromosomes. The telomere of S. mansoni contains the same repeat sequence as man: (TTAGGG)n (Hirai and LoVerde 1996) and Sm alpha is a repetitive DNA like-retrotransposon dispersed in genome of S. mansoni (Spotila et al. 1989; Hirai et al. 1989).

This protocol uses the PRINS reaction kit from Boehringer Mannheim, together with Taq DNA polymerase from GibcoBRL. Reagents from other manufacturers may work equally well but have not been tested.

• telomere: 5' - CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA - 3'
• Sm alpha -T750: 5' - CCCTTGGTTTCTTAGTGTTATAGCCC - 3'
• Sm alpha -F375: 5' - ACTATAGACGATAATACTAAAAGAC - 3'

The two Sm alpha primers are used as an equimolar pool

• 10 x labeling buffer - 3.0 ul
• 10 x reaction solution - 3.0 ul
• primer - 60~200 pmol
• Taq DNA polymerase 3.0 ul (3 u)
• ddH₂O to 30 µl

The reaction mixture is applied to a slide preparation and covered with a cover slip which is sealed in place with rubber cement. After the rubber cement has dried, the slide is placed onto a PCR block (a Hybaid Omni Gene in-situ Block (Hybaid, HB-Tr3-CMFB) ) has been used in all experiments).

Primer extension occurs by one cycle of 93^oC for 5 minutes (to denature chromosomal DNA) followed by 61^oC for 30 minutes (for primer annealing and extension). (Cycling PRINS has not yet been attempted.)

Carefully remove the rubber cement and cover slip, and stop the extension reaction by gently flooding the slide with 50 mM NaCl, 50mM EDTA at 60^oC for 3 minutes. Signal detection follows the technique of Hirai and LoVerde (Sorry but this one isn't in PubMed so we can't make a link to it. The full citation is: Hirai, H. and LoVerde, P. T. (1995) "FISH techniques for constructing physical maps on Schistosome Chromosomes." Parasitology Today 11(8), 310- 314).

Briefly:

1. immerse in 50ml of BN buffer (0.1 M sodium bicarbonate, 0.1 % Nonidet P-40) for 10 minutes
2. immerse in 50 ml of blocking buffer (5% nonfat milk in BN buffer) for 10 minutes
3. immerse in 50 ml of anti-digoxigenin-fluorescein conjugate (Boehringer Mannheim) (800 ng in blocking buffer) and incubate at 37^oC for 30 minutes in the dark.
4. wash with excess BN buffer on a shaker at room temperature to remove unbound conjugate
5. mount in 20 µl of anti-fade solution containing propidium iodide (30 ng/ml) and DAPI (30 ng/ml) to counterstain the chromosomes
6. cover with a cover slip, remove excess mountant and observe