The amplification of DNA fragments using the polymerase chain reaction (33) is performed in either the Perkin-Elmer Cetus DNA Thermal Cycler or the Perkin-Elmer Cetus Cycler 9600, by adding the following reagents to either a 0.2 ml thin-walled tube or a 1.5 ml tube, respectively: a small amount of the template DNA molecule (typically cosmid, plasmid, or genomic DNA), the two primers flanking the region to be amplified, nucleotides, buffer, and Retroelements and their derivatives are a ubiquitous and abundant component of plant genomes. From the 1990s, PCR based techniques have been developed to isolate the elements from genomic DNA of different plants, and the methods and primers used are presented here.
Major classes of retroelements include the Pseudoviridae (Ty1-copia ), the Metaviridae (Ty3 -gypsy) and the Retroposineae LINE (non-LTR) groups. All reverse transcribing elements can be included in a universal classification which is presented on a linked page . Mixed PCR products representing the full heterogeneous pool of retrotransposons from each group are obtained by PCR with degenerate primers ( degenerate nucleotide symbols link), as listed below. Some of the species tested are also listed, but experience of us and many others is that the primers succeed in most or all cases. Non-degenerate primers for amplifying individual transposons are obtained from sequences in the databases, and of course can be used at lower annealing temperatures to isolate elements. PCR protocols and programmes are given at the bottom of the page.
Revision 20-05-2005: Added New Paper Hill, Flavell et al. and emphasized Pseudo/MetaViridae (not Pseudovirideae or Metavirideae which would refer to another level of classification of retroelements or retrotransposons)
12/6/03: reduced amount of Taq polymerase recommended (we use enzyme from Promega from May 2004; previously we used BioLine but their prices increased substantially at that point).
Pseudoviridae (Ty1-copia) Degenerate Primers
These work for virtually every higher plant species (tested in over 75 species, failed in one). Upstream Primer: 5'ACNGCNTTYYTNCAYGG encoding TAFLHG Downstream Primer: 5'ARCATRTCRTCNACRTA encoding YVDDML (in reverse). These two primers, from Flavell et al. (1992 a and b below), amplify a band of approximately 270bp. The primer pair 5'CARATGGARGTNAARAC encoding QMDVKT and 5'CATRTCRTCNACRTA encoding YVDDM (missing the L at the end of the Flavell primers) is used by Hirochika and Hirochika (1993 below).
Original papers are by three groups at about the same time: Flavell AJ, Smith DB, Kumar A. 1992 Extreme heterogeneity of Ty1-copia group retrotransposons in plants. Mol Gene Genet 231: 233-242 Flavell AJ, Dunbar E, Anderson R, Pearce SR, Hartley R, Kumar A. 1992. Ty1-copia group retrotransposons are ubiquitous and heterogeneous in higher plants. Nucleic Acids Res. 20: 3639-3644.
Voytas DF, Cummings MP, Konieczny A, Ausubel FM, Rodermel SR. 1992. copia-like retrotransposons are ubiquitous among plants. Proc.Natl.Acad.Sci.USA 89: 7124-7128
Hirochika H, Hirochika R. 1993. Tyl-copia group retrotransposons as ubiquitous components of plant genomes. Jpn J Genet 68: 35-46; Hirochika H, Fukuchi A, Kikuchi F. 1992. Retrotransposon families in rice. Mol.Gen.Genet. 233: 209-216.
Metaviridae (Ty3-gypsy) Element Degenerate Primers
We (Heslop-Harrison and colleagues) have used the following in Hordeum (Vershinin et al., 2002), sugar beet (Kubis et al. 1998) and a variety of gymnosperms (Friesen et al. 2001, the original reference for these primers; see references page of this website for the citations ).
Forward primers: GyRT1 : 5' MRNATGTGYGTNGAYTAYMG encoding RMCVDYR GyRT3 : 5' YKNWSNGGNTAYCAYCARAT encoding LSGYHQI
Reverse primers
GyRT4 : 5' RCAYTTNSWNARYTTNGCR encoding YAKLSKC
GyRT1/GyRT4 will give a 420bp product. GyRT3/ GyRT4 will give an approx 300bp product.
Jump to nucleotide degeneracy symbols
These were published in Friesen et al. 2001, Kubis et al. 1998
Alan Schulman11 Forward primer: 5' GTITAWYKTIGAYGAYRTIYTIRT Reverse primer: 5' ICKYTCISWYTGICCRTCISTYTGIGG
Andy Flavell Gypsy Primers were in Molecular Biology and Evolution 2000 or MGG 2005. They work well in 4 out of 4 species tested to date (beans'n nematodes). The Ty3-gypsy-group retrotransposon sequences were amplified using primer 8717 (5-TAYCCNHTNCCNCGNATHGA-3) or 8718 (5-TAYCCNHTNCCNAGRATHGA-3), both encoding YPLPRID, together with 5-ARCATRTCRTCNACRTA-3, encoding YVDDML (Flavell et al. 1992a). The up-stream Ty3-gypsy primers were based on an alignment of the plant Ty3-gypsy elements CIN-full, Huck, Leviathan, Reina, Tekay (Jeff Bennetzen, personal communication), Del 1 (Accession No. X13886) and Ifg7 (AJ004945) – quoted from Hill et al. (2005 MGG – see below for citation)
LINE Element Degenerate Primers
Pat Heslop-Harrison These work well in Hordeum, Allium, Oryza, Secale, Nicotiana and Antirrhinum. 5' RVNRANTTYCGNCCNATHTC 3' (named BEL1) encoding [E/D/K/N/S][E/D/N] FRPIS 3' TCYGTCCCCCTRGGRRACAG 5' (BEL2) encoding RQGDPLS (very similar to Andy's downstream primer) Bel1/Bel2 PCR products should be approximately 410bp.
Modified with changed specificity at the 3' end by Sybille Kubis (Kubis SE, Castilho AMMF, Vershinin AV, Heslop-Harrison JS. 2003. Retroelements, transposons and methylation status in the genome of oil palm (E laeis guineensis ) and the relationship to somaclonal variation. Plant Molecular Biology 52 : 69-79), work well in oil palm and Brassica (Alix K, Heslop-Harrison JS. 2004 . The diversity of retroelements in diploid and allotetraploid Brassica species. Plant Molecular Biology 54 : 895-909) and mosses, ferns and liverwords (Elsebeth Kolmos)
BEL1MF: 5'-RVNRANTTYCGNCCNATHAG-3' and
BEL2MR: 5'-GACARRGGRTCCCCCTGNCK-3'.
Andy Flavell These work well in Vicia . Upstream Primer: 5' CCNGGNCCNGAYGGNWT encoding PGPDG[IMF] Downstream Primer: 5' SWNARNGGRTCNCCYTG encoding QGDPLSP or: 5' SWNARNGGRCANCCYTG encoding QGCPLSP These primers together amplify a band of approximately 650bp.
Hill P, Burford D, Martin DMA and Flavell AJ Retrotransposon populations of Vicia species with varying genome size Molecular Genetics and Genomics Published online: 13 May 2005 DOI: 10.1007/s00438-005-1141-x Have published more primers based on Wright et al (1996): Reverse transcriptase (rt) gene fragments were amplified from LINE retrotransposons in Vicia DNAs by degenerate PCR using primers DVO144 (5-GGGATCCNGGNCCNGAYGGNWT-3) and 10712 (5-SWNARNGGRTCNCCYTG-3), which were derived from those described by Wright et al. (Wright DA, Ke N, Smalle J, Hauge BM, Goodman HM, Voytas DF (1996) Multiple non-LTR retrotransposons in the genome of Arabidopsis thaliana. Genetics 142:569–578): probably for protein amino acids DPGPDG and QGDPLSP
PCR Programmes
Typical Mix for PCR amplification: We use 50 ul for both running on a gel and cloning, 15 ul for analysis of amplification alone. We use a Biometra T-gradient PCR machine.
|
Component |
Stock concentration |
Amount added (ul) |
Final amount/ concentration |
|
|
DNA |
12.5 ng/ul |
2 |
25ng |
|
|
dNTPs |
2.5 mM |
4 |
200 uM each |
|
|
Primer 1 |
10 uM |
5 |
50 nM.(50 pM total) |
|
|
Primer 2 |
10 uM |
5 |
|
|
|
MgCl2 |
50 mM |
3.5 |
3.5 mM |
|
|
Buffer 10x |
10X |
5 |
1x |
|
|
Water (high quality) |
|
31.5 |
|
Add first to tube |
|
Taq polymerase |
5U/ul |
0.25 |
5U |
Add last to tube |
|
Total |
|
50 |
The above protocol is designed to be very reliable. For larger scale and greater specificity, reduce volume to 25 ul or 15 ul, use 0.1 U Taq polymerase per tube and 25% of above primer concentrations. A 'no DNA' control is essential; at different times, we have had major problems with false positive amplifications, so now buy water from Sigma (or other molecular biology supply companies) for use in PCR, DNA dilution, cloning experiments and other critical applications using at most 100s of microlitres. Single-primer controls are also useful to run as some species have nested retroelements in inverted orientations. It is instructive to make 'dirty' controls - with tiny amounts of dust from the lab, your pockets, your hair, powder from gloves etc. (use a tiny amount: the same 'dirt' will inhibit the real reactions, and this inhibition can also be tested in with DNA controls). In a recent course, about 30% of the 'dirty' controls gave amplification products, compared to 5% of clean controls.
Cycling conditions:
Pat
94 °C, 3 mins
[39 °C / 50 secs,
72 °C / 40 secs,
94 °C / 1 min] X 30 cycles
72 °C / 5 mins
4 °C hold
Because the products are short, we usually analyse the products on 2% agarose gels, although note these are expensive and may make subsequent cloning more difficult. However, PCR product cloning kits such as the Invitrogen Topo AT cloning kit or Promega P-Gem T have overcome the difficulties of a few years ago.
Andy Flavell uses the following PCR temperatures (Techne Genius or ancient Hybaid) 95o 1 min [45oC / 1min, 72oC/ 1min, 94oC / 1 min] X 30 cycles 72oC / 7 mins
Alan Schulman
Specific LTR Primers for SSAP, REMAP and IRAP BARE-1 5' CTAGGGCATAATTCCAACAA. This corresponds to the first 19 bases of the BARE-1 LTR, facing outwards from the 5' LTR, plus one selective A base to inhibit internal priming within the BARE-1 element from the 3' LTR (see Waugh, Flavell et al 1997 for reference).
Thv19 5' GCCCAACCGACCAGGTTGTTACAG, corresponding to bases 48-
Some of this work was carried out under EU Framework IV projects TEBIODIV (coordinated by Dr Andy Flavell, University of Dundee) and a Gymnosperm retroelement EU grant (David Marshall, SCRI)
Link to full table on another page Nucleotide degeneracies
R = A + G; Y = C + T; M = A + C; S= G + C; W = A + T; and N = A + G + C + T.